Hieff NGS™ Full UDI Adapter Kit for Illumina, Set2 (Plate-Format) _ 12334ES

Yeasen - Leading Innovation in Molecular Enzymes and Reagents Verified independent store

→

Hieff NGS™ Full UDI Adapter Kit for Illumina is an adapter kit specifically designed for library preparation on Illumina high-throughput sequencing platforms. The kit contains UDI adapters used for next-generation sequencing (NGS) library preparation. Cat#12334–12336 are provided in plate format (Set1/Set2/Set3/Set4). Each set contains 96 adapters, enabling the construction of up to 384 uniquely dual-indexed libraries. All reagents included in the kit have undergone strict quality control and functional validation to ensure the stability and reproducibility of library preparation to the greatest extent. Specifications Cat.No. 12334ES01 / 12334ES02 Size 96×1 T / 96×2 T Components Components No. Name 12334ES01 (96×1 T) 12334ES02 (96×2 T) 12334 UDI Adapter 097-192 5 μL each 10 μL each Storage This product should be stored at -25~-15℃ for 2 years. Notes 1. The concentration of the UDI adapters in this kit is 10 μM. The amount of adapter used for each library preparation should be adjusted according to the requirements of the library preparation kit being used. 2. Do not heat the adapters. Allow them to dissolve slowly at room temperature. The laboratory temperature is recommended to be maintained at 20–25°C. Avoid repeated freeze–thaw cycles. It is recommended to aliquot the adapters for storage, and they may be stored at 4°C for short-term use. 3. The structure of the DNA library constructed using the Hieff NGS™ Full UDI Adapter Kit for Illumina is shown below. 4. For your safety and health, please wear a lab coat and disposable gloves when performing the experiment. 5. This product is for research use only. Sequence Information UDI Adapter for Illumina： i5 Index for Illumina： 5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´ i7 Index for Illumina： 5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7 Index]ATCTCGTATGCCGTCTTCTGCTT*G-3´ The notation [i5 Index] denotes an 8-bp i5 index sequence, and [i7 Index] denotes an 8-bp i7 index sequence. The corresponding positions of each adapter in the 96-well plate are shown in the figure below. Documents Safety Data Sheet 12334_MSDS_HB20260316 Manuals 12334_Manual_HB20260421 Show more