TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA. Features Excellent cut-and-paste performance. The integrity of dsDNA product end closure is greater than 90%. Applications DNA Enzymatic Synthesis. Specifications Unit Definition One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30oC for 30 minutes. Recognition Sites TATCAGCACACAATTGCCCATTATACGC↓GCGTATAATGGACTATTGTGTGCTGATA ATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT Heat Inactivation 75℃ for 5 min Components Components No. Name 14540ES72 14540ES80 14540ES90 14540-A TelN Protelomerase (5 U/μL) 50 μL 200 μL 1 mL 14540-B 10 X TelN Reaction Buffer 250 μL 1 mL 5 X 1 mL Shipping and Storage This product should be stored at -25 ~ -15oC for 1 years. Figures Figure 1.Protelomerase cleavage activity detection of TelN M:Marker, C: supercoiled plasmid control Figure 2.TelN Protelomerase end closure integrity test. C1: plasmid containing TelN recognition site, without TelN Protelomerase; C2: plasmid containing TelN recognition site, TelN Protelomerase, without T5 exonuclease; Plasmid: plasmid containing TelN recognition site. Documents: Safety Data Sheet 14540_MSDS_Ver.EN20250120.pdf Manuals 14540_Manual_Ver.EN20240419.pdf Related Blog: TelN Telomerase: A New Drive in DNA Enzymatic Synthesis
