The Replication-competent AAV Serotype 2 (rcAAV2) Detection Kit is designed to quantitatively analyze and detect the potential risk of Replication Competent Adeno-associated Virus (rcAAV) in a variety of gene therapy, oncology and vaccine development products using recombinant adeno-associated viral vectors with AAV2 serotype. This kit is based on the principle of fluorescent probe quantitative PCR, and uses qPCR to detect rAAV terminal repeat sequence (ITR) (i.e. Reference gene) and rcAAV linked sequence (i.e. Target gene) respectively, realizing the quantitative detection of rAAV and rcAAV at the same time. The kit also contains DNA quantitative references for the reference gene and the target gene (rcAAV2 Reference&Target DNA Control). Before using this kit, make sure that the sample to be tested also meets the following conditions: 1. The serotype of the adeno-associated virus in the sample to be tested is AAV2; 2. The ITR sequence of the recombinant adeno-associated viral vector rAAV in the sample to be tested needs to be matched with the ITR sequence of rAAV2 as described below: >rAAV-2/N ITR sequence: TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT Features Compliance with regulations: the products are fully validated according to the requirements of Chp, USP, ICH, etc., and their performance is in line with Chinese and foreign regulations and standards; Guarantee of quality: the raw materials of the kits are all self-developed, and the qPCR Mix and other enzyme products are produced in an ultra-clean enzyme factory; High sensitivity: the lower limit of quantification (LLOQ) was 2 copies/uL; High precision: high intra-batch reproducibility CV
